Theory of Biological Evolution — Introduction to Paleontology (Part II)
- 演化之聲
- Mar 9
- 5 min read
Updated: Mar 27
When learning about paleontology, a question often arises: why do organisms from the Paleozoic, Mesozoic, and Cenozoic eras appear so different from one another? Likewise, why do organisms living in different ecological environments develop distinct forms that suit the survival requirements of their surroundings? To understand such biological changes, one must examine the internal mechanisms that drive biological evolution.
Evolutionary Theory
The theory of biological evolution was first proposed by Charles Darwin. In 1859 he published the influential work On the Origin of Species, in which he described how natural selection in the environment influences the survival and elimination of organisms, thereby driving the evolutionary transformation of species. Later, the pea-plant inheritance experiments conducted by Gregor Johann Mendel also made major contributions to the understanding of biological evolution.
To thoroughly understand biological evolution, it is necessary to examine life at its most fundamental level. Only by beginning with the basic components of living organisms can we truly understand the mechanisms through which evolution operates. For this reason, the discussion will begin from a microscopic perspective before returning to the macroscopic scale.
The Molecular Perspective
Approaching evolution from a molecular perspective requires first understanding the basic principles of DNA. Living organisms are composed of cells, and most cells contain a nucleus. Within this nucleus lies the genetic material known as deoxyribonucleic acid, or DNA (Figure 1).
DNA molecules are extremely long. In eukaryotic organisms they exist in the form of chromosomes, which are distributed in a dispersed state throughout the cell nucleus. During cell division, however, these chromosomes condense into distinct rod-like structures. Each chromosome consists of a single DNA molecule, and chromosomes are formed when DNA is tightly wrapped around proteins known as histones (Figure 2).
For example, humans possess 23 pairs of chromosomes. The first chromosome measures approximately 10 micrometers in its condensed form, yet if the DNA molecule within that chromosome were stretched out fully, it would reach a length of about 8.14 centimeters.
DNA is composed of four types of paired deoxyribonucleotides. Their nitrogenous bases are adenine (A), thymine (T), cytosine (C), and guanine (G). Each base is commonly represented by its initial letter: A, T, C, and G. Adenine pairs only with thymine, and cytosine pairs only with guanine. These pairings form the double-stranded structure of DNA (see the lower-left portion of Figure 2). For instance, the first human chromosome consists of approximately 248 million base pairs. The sequence in which A, T, C, and G are arranged determines which RNA molecules and proteins will be produced during cellular processes.
The presence of DNA is essential for the functioning of cells, because all biological activities of the cell originate from the sequences of A, T, C, and G in DNA. Consider a protein found in human (Homo sapiens) cells: β-actin, which is a component of microfilaments within the cytoskeleton. The coding DNA sequence for β-actin is as follows (human DNA is double-stranded, but only one strand is shown here):
ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG
Through the action of RNA polymerase, the DNA sequence is transcribed to produce messenger ribonucleic acid (mRNA), which is single-stranded. The sequence remains the same as the DNA template except that thymine (T) is replaced with uracil (U), and the ribose sugar contains an oxygen atom at the second carbon position rather than being deoxygenated. (Note: this description has been simplified; actual gene structures also contain non-coding sequences. Readers interested in more detail may consult specialized textbooks.):
AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAUGUGCAAGGCCGGCUUCGCGGGCGACGAUGCCCCCCGGGCCGUCUUCCCCUCCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAUGGUGGGCAUGGGUCAGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUCCUCACCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACGACAUGGAGAAAAUCUGGCACCACACCUUCUACAAUGAGCUGCGUGUGGCUCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUGAACCCCAAGGCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACCCCAGCCAUGUACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUGGCCGUACCACUGGCAUCGUGAUGGACUCCGGUGACGGGGUCACCCACACUGUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCGUCUGGACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCGAGCGCGGCUACAGCUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGACAUUAAGGAGAAGCUGUGCUACGUCGCCCUGGACUUCGAGCAAGAGAUGGCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCCUGACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGGCACUCUUCCAGCCUUCCUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGAAACUACCUUCAACUCCAUCAUGAAGUGUGACGUGGACAUCCGCAAAGACCUGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGCAUUGCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAAUGAAGAUCAAGAUCAUUGCUCCUCCUGAGCGCAAGUACUCCGUGUGGAUCGGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAGCAGAUGUGGAUCAGCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAAUGCUUCUAG
After the mRNA moves from the nucleus into the cytoplasm, ribosomes carry out translation, producing the amino-acid sequence that forms the β-actin protein:
MDDDIAALVVDNGSGMCKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIVTNWDDMEKIWHHTFYNELRVAPEEHPVLLTEAPLNPKANREKMTQIMFETFNTPAMYVAIQAVLSLYASGRTTGIVMDSGDGVTHTVPIYEGYALPHAILRLDLAGRDLTDYLMKILTERGYSFTTTAEREIVRDIKEKLCYVALDFEQEMATAASSSSLEKSYELPDGQVITIGNERFRCPEALFQPSFLGMESCGIHETTFNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISKQEYDESGPSIVHRKCF
The resulting β-actin protein then performs its biological functions within the cell. Current estimates suggest that human cells are capable of producing more than 25,000 types of proteins and over 80,000 types of RNA (including many forms beyond mRNA, though only mRNA can be translated into proteins). These proteins and RNA molecules carry out the numerous functions required for cellular life.
From this discussion, it becomes clear that DNA is the fundamental source of life's processes. During reproduction, organisms replicate their DNA and pass it on to the next generation. DNA replication is carried out by enzymes known as DNA polymerases. However, DNA polymerase does not replicate DNA with perfect accuracy. In other words, it cannot reproduce the original DNA sequence with 100 percent fidelity. In eukaryotic organisms, DNA polymerase typically makes one copying error for every 100,000 to 1,000,000 base pairs (the exact rate varies among species). If we consider the length of the first human chromosome, a single round of replication would introduce roughly 200 to more than 2,000 base-pair errors (Figure 4). Once mutations occur in DNA, they may alter the sequence and molecular structure of proteins or RNA, which in turn can change the phenotype of an organism.
Such a high potential error rate would often be lethal if left unchecked, so living organisms possess DNA repair mechanisms that greatly reduce replication mistakes. These mechanisms lower the error rate to roughly one mistake per ten billion base pairs. Nevertheless, over many generations, even this extremely low mutation rate accumulates and generates genetic diversity within a population. Each individual carries DNA sequences that differ slightly from those of others. In addition, sexual reproduction increases diversity through recombination between homologous chromosomes. When the DNA differences between two populations become sufficiently large, they may eventually become separate species. This process provides one of the driving forces of biological evolution. Organisms with higher DNA replication error rates tend to evolve more rapidly, whereas species with lower mutation rates require longer periods to accumulate genetic diversity.
As mentioned earlier, individuals within a genetically diverse population possess slight differences in their DNA sequences. These differences can lead to variation in outward characteristics. In humans, for example, some individuals are tall while others are short; some have single eyelids while others have double eyelids; some have larger mouths while others have smaller ones; skin tone may vary from darker to lighter; and facial appearance differs among individuals. Such variations arise because DNA sequences direct the production of proteins and RNA that regulate embryonic development and postnatal growth.
When most individuals within a population experience selection acting on their traits—for instance natural selection (such as climate change, geographic changes, or geographic isolation) or sexual selection (when certain traits are favored by potential mates)—evolution begins to operate.
Evolution requires genetic diversity within a population so that certain individuals possessing advantageous traits can be retained (Figure 5). The individuals that survive will reproduce and generate a new population with its own genetic diversity, and the gene pool of this new population rarely remains identical to that of the previous one. If the original population continues to survive in its environment, it may persist alongside the new population; if it cannot survive, it will eventually become extinct while the new lineage continues. This is the process of evolution.
After introducing the mechanisms of biological evolution, it is hoped that readers will approach paleontology from an evolutionary perspective and better understand why certain species develop particular phenotypes within specific environments.
Author: Shui-Ye You
Comments